| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.000006 |
| Chromosome: | chromosome 6 |
| Location: | 5910069 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g289850 | SBE1 | (1 of 3) 2.4.1.18 - 1,4-alpha-glucan branching enzyme / Glycogen branching enzyme; Starch Branching Enzyme 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGGCCACACCTCCGTCCACCTCGTGCTCTATGCGCTGGCTGGGTCTTGCT |
| Internal bar code: | CTGATCCGTTTAAATATCTTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 483 |
| LEAP-Seq percent confirming: | 55.5556 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGACACCCTACCCCAATCT |
| Suggested primer 2: | AGGCATGAAAACACACGTGC |