| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.000008 |
| Chromosome: | chromosome 6 |
| Location: | 939349 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g256300 | PPP20,PBCP2,PBCP-LIKE | (1 of 9) PF07228 - Stage II sporulation protein E (SpoIIE) (SpoIIE); Phosphoprotein phosphatase 2C-related | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGGCGGGAATGCTTGCGGCGGTGTCGGTGGGAGGTGACAGCGGCTGCA |
| Internal bar code: | ATTCAAATGTAAGTACTCAATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1451 |
| LEAP-Seq percent confirming: | 86.8421 |
| LEAP-Seq n confirming: | 33 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 38 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACACTGCGACAGAGGAGT |
| Suggested primer 2: | TTGGCTTACTTGGCGGATGT |