| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.000019 |
| Chromosome: | chromosome 10 |
| Location: | 3887677 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g446350 | CGLD14 | Conserved in the Green Lineage and Diatoms; (1 of 1) PTHR31407//PTHR31407:SF17 - FAMILY NOT NAMED // PSBP DOMAIN-CONTAINING PROTEIN 3, CHLOROPLASTIC | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCCGGTATGGCCGATCCAGGCGCCCGGCGGACGCTGGCTTGGTTCCCG |
| Internal bar code: | AACGAACCACAGTCTTGGTGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1453 |
| LEAP-Seq percent confirming: | 97.1429 |
| LEAP-Seq n confirming: | 34 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCACATCCAACCCTGCTGTC |
| Suggested primer 2: | ACGATCATCGCTCCATGGTC |