| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.000023 |
| Chromosome: | chromosome 2 |
| Location: | 6184545 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g120150 | RBCS2 | (1 of 2) K01602 - ribulose-bisphosphate carboxylase small chain (rbcS); Ribulose-1%252C5-bisphosphate carboxylase/oxygenase small subunit 2, chloroplastic | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACAAGAGAAGTCACTCAACATCTTAAAATGGCCGCCGTCATTGCCAAGTC |
| Internal bar code: | TTGATGTCAAAGGGGCCGTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2017 |
| LEAP-Seq percent confirming: | 78.0 |
| LEAP-Seq n confirming: | 39 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 50 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAAGAAAAAGCCGCCGAAA |
| Suggested primer 2: | TCCCCTGCACGATGGTAGTA |