Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.000061 |
Chromosome: | chromosome 6 |
Location: | 940061 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g256300 | PPP20,PBCP2,PBCP-LIKE | (1 of 9) PF07228 - Stage II sporulation protein E (SpoIIE) (SpoIIE); Phosphoprotein phosphatase 2C-related | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCCAGCAAAGTCGGGCGGCACCGCGACTGCAACACTGCGACAGAGGAGT |
Internal bar code: | CGCCAATGATGCTCTTGATTAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2432 |
LEAP-Seq percent confirming: | 97.5904 |
LEAP-Seq n confirming: | 81 |
LEAP-Seq n nonconfirming: | 2 |
LEAP-Seq n unique pos: | 83 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTGGCTGCAAACAGTGAGG |
Suggested primer 2: | TGTACGGCGGTTGTTCGTTA |