| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.000064 |
| Chromosome: | chromosome 4 |
| Location: | 1432854 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g214200 | (1 of 30) IPR000253 - Forkhead-associated (FHA) domain | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCTTAGTGCAAAATACAAGACTCTGGCGCCTGTGCTCTTACCGTATGGG |
| Internal bar code: | TGGCATTTTGAATCAACAGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1562 |
| LEAP-Seq percent confirming: | 95.7143 |
| LEAP-Seq n confirming: | 67 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 70 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTACAGGACAGGAAAGGGC |
| Suggested primer 2: | TTTCCCCTGTGTACTCGCAC |