Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.000196 |
Chromosome: | chromosome 7 |
Location: | 3337316 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre07.g334900 | (1 of 3) IPR004089 - Methyl-accepting chemotaxis protein (MCP) signalling domain | outside_mRNA | |
Cre07.g334950 | (1 of 107) PF00069//PF07714 - Protein kinase domain (Pkinase) // Protein tyrosine kinase (Pkinase_Tyr) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGACCCTGTACCCTGTACCCAGACCCTGACTCTTAGCCTTCACGGCCT |
Internal bar code: | AACGAGGCGCGGACCTTCATCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4065 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 57 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACAGGCAGGTGTTCCAAACA |
Suggested primer 2: | CTCGCTGGGGACTCGTTATC |