| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.000239 |
| Chromosome: | chromosome 7 |
| Location: | 5541629 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g351650 | BUG22,FAP20 | Transcription Factor 2-Like Flagellar Associated Protein 20; (1 of 3) PF05018 - Protein of unknown function (DUF667) (DUF667) | outside_mRNA |
| Cre07.g351700 | (1 of 1) PTHR19315:SF9 - ER MEMBRANE PROTEIN COMPLEX SUBUNIT 4 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTGCTCAGGGCCGCACTCACCCTCTGGGCGTGCCCTTAGGCCGAGGGG |
| Internal bar code: | GTGGATTACTGAGCGAGGTCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3380 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 98 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 98 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACGTCGCTCATCAATGCTG |
| Suggested primer 2: | CTGGACGCGAACGCCTATAT |