Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.000280 |
Chromosome: | chromosome 16 |
Location: | 6406112 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g675300 | PHT8,PHT4-8,MFT9,PHT4H | Sodium-dependent phosphate transporter, major facilitator superfamily; (1 of 2) PTHR11662//PTHR11662:SF226 - SODIUM-DEPENDENT PHOSPHATE TRANSPORTERS // FI19708P1 | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGGCCCCGCCATTGCATAGCTGCCTTGTGCAGCTTCCTTTCATTATCT |
Internal bar code: | TTTGTCCCCATGGCGGCAGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3743 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 56 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TTCGGGATCCCCAACCATTG |
Suggested primer 2: | GCTTGTAACCCTCCCACCTC |