| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.000318 |
| Chromosome: | chromosome 11 |
| Location: | 1932798 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467781 | ARB1,FAP151 | (1 of 2) K06185 - ATP-binding cassette, subfamily F, member 2 (ABCF2); Soluble ABC-F domain containing protein | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCACAAGCCAACGCGTAAAGCAAGGCAAACATCACGGGTGTTGCCTCATC |
| Internal bar code: | GTATGTTTCGGTTGCTTATCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2469 |
| LEAP-Seq percent confirming: | 96.1538 |
| LEAP-Seq n confirming: | 25 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCTACGCCTCTTACGTCGAC |
| Suggested primer 2: | ACACATGTGCCTCAGTCCTG |