Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.000331 |
Chromosome: | chromosome 14 |
Location: | 3770686 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre14.g632000 | CGE2,OPR65 | GrpE nucleotide release factor; (1 of 3) K03687 - molecular chaperone GrpE (GRPE) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGGCAAGGTGCACGCGGCGAACGCGTCAGCGCCCAGCTCGCCGCCGCTG |
Internal bar code: | GGGCTCTGTACAAACAAGGTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4221 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 26 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 26 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGTAGCAGTGGCAGCAGTA |
Suggested primer 2: | GGCCCGTCACTAGCTCAATT |