| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.000447 |
| Chromosome: | chromosome 9 |
| Location: | 4151900 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g399552 | LCR1 | Low-CO2 response regulator, Myb-like transcription factor; (1 of 25) IPR001005//IPR009057//IPR017930 - SANT/Myb domain // Homeodomain-like // Myb domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGCAGTAATAGGCACAATCACTTATGTGTCTGTACCAGGCTGAGCCCA |
| Internal bar code: | GGTCAGTTGTTGGAAGACGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1766 |
| LEAP-Seq percent confirming: | 94.8276 |
| LEAP-Seq n confirming: | 55 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 58 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGAAAGTCCTCCAACCGTCG |
| Suggested primer 2: | TAATACAATCCGCCTCCCGC |