Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | + |
Strain: | CLIP2.000476 |
Chromosome: | chromosome 16 |
Location: | 3257469 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g666050 | CPLD49,SCD1 | (1 of 4) PF03435 - Saccharopine dehydrogenase NADP binding domain (Sacchrp_dh_NADP); Cytochrome b6f biogenesis protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTAGAAGAAAAGCCAACGACTAAATACAGTACAAGAACAAAACGATGACT |
Internal bar code: | TGTGGAAATTAGACTAGTGGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 4740 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 100 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 100 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CACTTGTATCGCGCGTTGAG |
Suggested primer 2: | GCTTGGAGGATGCAGAACCT |