| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.000483 |
| Chromosome: | chromosome 9 |
| Location: | 1992430 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g396950 | MFT25,CGL15,PHT4I,PHT4-9 | Na+-dependent inorganic phosphate cotransporter; (1 of 4) K08193 - MFS transporter, ACS family, solute carrier family 17 (sodium-dependent inorganic phosphate cotransporter), other (SLC17A) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TAGGGAGGCGCGGCGTAATAAACAGGGCGGCGGTGTACGATGCTGAATGT |
| Internal bar code: | TGGTTCTGATTCGGTCAACATC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2264 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 6 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGTTGTTGGCGAAGTGTG |
| Suggested primer 2: | TCCAAACCCATGCCATCCTC |