| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.000540 |
| Chromosome: | chromosome 12 |
| Location: | 4227415 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g518050 | FAP261 | Flagellar Associated Protein 261; (1 of 2) PTHR16306:SF0 - TRANSLIN-ASSOCIATED FACTOR X-INTERACTING PROTEIN 1 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGGTGGATGGAGCCCGTGACTTTGTGCGCCGCCGCCGAACCGCACACTG |
| Internal bar code: | TGGCGTAACTAGGTTTTTGGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1194 |
| LEAP-Seq percent confirming: | 97.2973 |
| LEAP-Seq n confirming: | 36 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 37 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGAAACTGTAGGGTCGTGCA |
| Suggested primer 2: | TTGCCTAGCCACTAAGCCAC |