| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.000554 |
| Chromosome: | chromosome 14 |
| Location: | 1324365 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g616600 | FZL,FZL1 | Plastid-localized; (1 of 1) PTHR11649//PTHR11649:SF36 - MSS1/TRME-RELATED GTP-BINDING PROTEIN // FZL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGGCGCGAGTCTGTGGGTAGCGCTGGGGGCGGCGCGCGGATGGGCCG |
| Internal bar code: | CCAAATGCTAGGGAGATTTTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4602 |
| LEAP-Seq percent confirming: | 95.4955 |
| LEAP-Seq n confirming: | 106 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 111 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTGACCCCTCTCCCTACCC |
| Suggested primer 2: | CAACGGATGGAAAGTGCGTC |