| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.000560 |
| Chromosome: | chromosome 3 |
| Location: | 5382084 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g183550 | (1 of 3) PTHR15160//PTHR15160:SF4 - VON HIPPEL-LINDAU PROTEIN // PROTEIN F23H11.5 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTTACCGGTGGCCGGGTCCCCAAAGAATAGGCGCCCCACGAAGATGTC |
| Internal bar code: | TGTTGTGCTGTACTGGTCTGTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1460 |
| LEAP-Seq percent confirming: | 33.3333 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGACCAGAGTCGTGTCTGC |
| Suggested primer 2: | GCAGCTTGATGGCATCCATG |