| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.000601 |
| Chromosome: | chromosome 9 |
| Location: | 6504105 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g415550 | OPR43,ASA2 | Mitochondrial F1F0 ATP synthase associated protein 2 | 3'UTR_intron |
| Cre09.g415600 | (1 of 5) 3.2.1.3 - Glucan 1,4-alpha-glucosidase / Lysosomal alpha-glucosidase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCAGGGCTCCTATCTTAATGTCTCCAGACATTAATTGGCCATTTTGGCCG |
| Internal bar code: | GGAAAGAAATGTGAGCTCAGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4798 |
| LEAP-Seq percent confirming: | 91.4286 |
| LEAP-Seq n confirming: | 32 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCTGGTTGGACAGATGCGT |
| Suggested primer 2: | AGCTCAGGATCTCACCCCAT |