Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.000641 |
Chromosome: | chromosome 10 |
Location: | 2487375 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g435800 | CSP41b,CSP41B,SNE11,RAP38 | Chloroplast stem-loop-binding protein 41b; (1 of 1) PTHR10366:SF289 - CHLOROPLAST STEM-LOOP BINDING PROTEIN OF 41 KDA B, CHLOROPLASTIC | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATAAATGGCCACCCCTTGCCCTTCCCCACCGAACCACCACCAAAGCTGA |
Internal bar code: | CGTATGAGTCTAATTGACGTTA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1850 |
LEAP-Seq percent confirming: | 100.0 |
LEAP-Seq n confirming: | 53 |
LEAP-Seq n nonconfirming: | 0 |
LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGACGCATGTCTCATTGCTG |
Suggested primer 2: | TGAACAGAGTCACGTCGTGG |