| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.000749 |
| Chromosome: | chromosome 5 |
| Location: | 3139074 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre24.g755997 | PHC18,FAP150 | Pherophorin-like Flagellar Associated Protein 150; (1 of 71) PF12499 - Pherophorin (DUF3707) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGCCCTCTCCTCCTCCTCCTTCGCCCGTCCCTCCCTCTCCTCCTCCTC |
| Internal bar code: | AACTGGCTACGACATTACCATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 91 |
| LEAP-Seq percent confirming: | 39.2857 |
| LEAP-Seq n confirming: | 11 |
| LEAP-Seq n nonconfirming: | 17 |
| LEAP-Seq n unique pos: | 28 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGGAAGTAGTCGTTTGCGCT |
| Suggested primer 2: | GCCAAACCAGCCTGCTACTA |