| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.000782 |
| Chromosome: | chromosome 4 |
| Location: | 2682866 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g223300 | CCP1 | (1 of 5) K15109 - solute carrier family 25 (mitochondrial carnitine/acylcarnitine transporter), member 20/29 (SLC25A20_29, CACT, CACL, CRC1); Low-CO2-inducible chloroplast envelope protein | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTTGTACACCTCCGACGGCGGCAGCTTGGCCGCCAGGGCAGTGCCCTG |
| Internal bar code: | ATATTGTCTTTTAGTGTATGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3198 |
| LEAP-Seq percent confirming: | 92.3077 |
| LEAP-Seq n confirming: | 12 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAGAATGTCATCCGACGC |
| Suggested primer 2: | AGCGATAGACGGCCAATCTG |