| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.000791 |
| Chromosome: | chromosome 5 |
| Location: | 3140823 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre24.g755997 | PHC18,FAP150 | Pherophorin-like Flagellar Associated Protein 150; (1 of 71) PF12499 - Pherophorin (DUF3707) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTTTGCGCCTCATCGTGAGGCCAGTGAACGCAAGCACGCCGTCACAGTA |
| Internal bar code: | AGCCATAGAACGAGTATTCCCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1509 |
| LEAP-Seq percent confirming: | 88.8889 |
| LEAP-Seq n confirming: | 24 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCAGATCTGCCTCACGATC |
| Suggested primer 2: | TGTTTAGCTCGTGAACGGCT |