| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.000797 |
| Chromosome: | chromosome 3 |
| Location: | 5735731 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g187150 | (1 of 1) IPR001623//IPR027986//IPR027989//IPR028031 - DnaJ domain // T-cell activation inhibitor, mitochondrial // Domain of unknown function DUF4461 // Domain of unknown function DUF4460 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCGCTATTACCATAACCCTTGTATGATTATACCCATATTGTTTGAGTGTT |
| Internal bar code: | TGGTGCCTGGGGGTATTCCCAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2574 |
| LEAP-Seq percent confirming: | 83.3333 |
| LEAP-Seq n confirming: | 5 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGTGGAGCTGAGCTGTCA |
| Suggested primer 2: | TGTGACGTCCTGAAGCTCAC |