Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | + |
Strain: | CLIP2.000800 |
Chromosome: | chromosome 16 |
Location: | 7761930 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g687294 | FTRV1,FTRV | Ferredoxin Thioredoxin reductase, variable subunit%252C chloroplastic; (1 of 1) PTHR10949//PTHR10949:SF11 - LIPOYL SYNTHASE // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTGCTTCGGCGCATGGAAGACCTTAACGGAAGCGATCACCTTGACCTTC |
Internal bar code: | AAACTATCATTTAGTATATGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3711 |
LEAP-Seq percent confirming: | 78.9474 |
LEAP-Seq n confirming: | 15 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 19 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGCCCGTAGTCCATCAACAC |
Suggested primer 2: | CCACAACTCACGAGTCACGA |