| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.000865 |
| Chromosome: | chromosome 2 |
| Location: | 6198439 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g120250 | CDPK7,STT7 | (1 of 3) PTHR11584:SF316 - SERINE/THREONINE-PROTEIN KINASE STN7, CHLOROPLASTIC; Chloroplast protein kinase required for state transitions | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACACCATCGTACATTTTCTGCCGTTTTGGTGGGCTTGAGCACGCCATA |
| Internal bar code: | TTAATGTGGTCAAGTGCTACCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3782 |
| LEAP-Seq percent confirming: | 93.4211 |
| LEAP-Seq n confirming: | 71 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 76 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGCGGAGGAAAATCTGGTG |
| Suggested primer 2: | GTCGATGCTCCTGTAGACCG |