| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.000930 |
| Chromosome: | chromosome 5 |
| Location: | 1829455 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g235500 | KIN7A,KIN7-1 | Kinesin motor protein; (1 of 1) PTHR24115//PTHR24115:SF70 - FAMILY NOT NAMED // KINESIN-RELATED PROTEIN 11 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGCAGGTGGTTGGGATCCAGTTTGTGCGGTAGTGCTGCACACGACTGCG |
| Internal bar code: | ACTTGTTTTAAGTAAACCGTAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4082 |
| LEAP-Seq percent confirming: | 88.0952 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCGACACGTACGGTACTGAG |
| Suggested primer 2: | CTTCACACCGCTCTCCTGTT |