| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.000934 |
| Chromosome: | chromosome 3 |
| Location: | 4130468 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g172700 | outside_mRNA | ||
| Cre03.g172750 | (1 of 1) IPR002893//IPR012677 - Zinc finger, MYND-type // Nucleotide-binding alpha-beta plait domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCAGTCCTAGGTTTTTGCAAAGTGGCAGAGTCGGGTGTAGCGTGTGCCA |
| Internal bar code: | AATCTAGAATCTATGAAGGTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 4318 |
| LEAP-Seq percent confirming: | 93.0233 |
| LEAP-Seq n confirming: | 40 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 43 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACGAGTCTGCAGGAGTT |
| Suggested primer 2: | ACTGCCGCGATTGGATATGT |