Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.000952 |
Chromosome: | chromosome 10 |
Location: | 340389 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g420350 | PSAE,PSAE1 | (1 of 1) K02693 - photosystem I subunit IV (psaE); Photosystem I reaction center subunit IV, 8.1 kDa | CDS |
Cre10.g420400 | (1 of 1) K14289 - exportin-5 (XPO5) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGAACATCGCGGGTGCGTGATCGGCAAACTCCGAATCATGTCGCCGCCC |
Internal bar code: | TGTATTCAGCATCGTTACGCTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1674 |
LEAP-Seq percent confirming: | 33.3333 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TCCGATCGCCAAGTCTATGC |
Suggested primer 2: | AGAGTTGCTGGAAACCGAGG |