| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.000965 |
| Chromosome: | chromosome 14 |
| Location: | 3768308 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g632000 | CGE2,OPR65 | GrpE nucleotide release factor; (1 of 3) K03687 - molecular chaperone GrpE (GRPE) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCATCCTGCTTCCGAGCCGATGTGCTGCTTGCTGGCAATGTATGTGCTA |
| Internal bar code: | CAGTGCGTGAGGGTCAATCACA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 551 |
| LEAP-Seq percent confirming: | 5.0 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 38 |
| LEAP-Seq n unique pos: | 40 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAAATCCCAGCAAACACGCC |
| Suggested primer 2: | CACAGAAAGCAAGCTGGCTG |