Insertion cassette: | CIB2 |
Side of cassette: | 3' |
Strand: | - |
Strain: | CLIP2.001016 |
Chromosome: | chromosome 10 |
Location: | 850294 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g423500 | HMO1,HMOX1 | Heme oxygenase; (1 of 1) PTHR35703//PTHR35703:SF2 - FAMILY NOT NAMED // HEME OXYGENASE 4, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCCAGCTACCGTCGGTACAGTAACAGCGCGCGAACGACGCACCAATGC |
Internal bar code: | GCGGTAAGGTGGGCAACCAGCC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 2993 |
LEAP-Seq percent confirming: | 48.5714 |
LEAP-Seq n confirming: | 17 |
LEAP-Seq n nonconfirming: | 18 |
LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTTCCATGTCCTATCGCGA |
Suggested primer 2: | GTGTTGTGCGCCTGATTTGT |