| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.001016 |
| Chromosome: | chromosome 10 |
| Location: | 850294 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g423500 | HMO1,HMOX1 | Heme oxygenase; (1 of 1) PTHR35703//PTHR35703:SF2 - FAMILY NOT NAMED // HEME OXYGENASE 4, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGCCAGCTACCGTCGGTACAGTAACAGCGCGCGAACGACGCACCAATGC |
| Internal bar code: | GCGGTAAGGTGGGCAACCAGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2993 |
| LEAP-Seq percent confirming: | 48.5714 |
| LEAP-Seq n confirming: | 17 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTCCATGTCCTATCGCGA |
| Suggested primer 2: | GTGTTGTGCGCCTGATTTGT |