| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.001033 |
| Chromosome: | chromosome 17 |
| Location: | 3216055 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g721500 | GBSS1A,STA2,GBBSI,GBS1 | (1 of 2) 2.4.1.242 - NDP-glucose--starch glucosyltransferase / Waxy protein; Granule-bound starch synthase IA | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGCGAACAAGGGAATTCATGCACAAACGTGGGCTAGCATCCTCTGGCCT |
| Internal bar code: | GTGTGGGGGTGGAGAGTCTTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1508 |
| LEAP-Seq percent confirming: | 82.3529 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGAGGTTCAGAGACACGCA |
| Suggested primer 2: | GGTACGCAACCTGAACCTCA |