Insertion cassette: | CIB2 |
Side of cassette: | 5' |
Strand: | - |
Strain: | CLIP2.001035 |
Chromosome: | chromosome 10 |
Location: | 3888693 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre10.g446350 | CGLD14 | Conserved in the Green Lineage and Diatoms; (1 of 1) PTHR31407//PTHR31407:SF17 - FAMILY NOT NAMED // PSBP DOMAIN-CONTAINING PROTEIN 3, CHLOROPLASTIC | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGTCGAGGGTTGTACGCTCTGTTTGTGTTATAAACCTATATATAGTACTG |
Internal bar code: | CCTTTTGGTATTGCTTGGCAAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 3443 |
LEAP-Seq percent confirming: | 96.25 |
LEAP-Seq n confirming: | 77 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 80 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACCATGGAGCGATGATCGTC |
Suggested primer 2: | GGAGGGCACAATTCCCATGA |