| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.001046 |
| Chromosome: | chromosome 6 |
| Location: | 934210 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g256250 | TEF14 | Thylakoid lumenal protein; (1 of 1) PTHR35742//PTHR35742:SF1 - FAMILY NOT NAMED // THYLAKOID LUMENAL 16.5 KDA PROTEIN, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGTTCGCTATGTAGCTTGGCAGCCCCGCCCCTCACGTTCCACAACAGGA |
| Internal bar code: | ACGCGCGGAGCACGATAATGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1929 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 35 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 35 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGTTTGGGTGAGGCTTGT |
| Suggested primer 2: | CTGGAAAGGTTGTCCGTCGA |