| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.001057 |
| Chromosome: | chromosome 3 |
| Location: | 5896563 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g188700 | PLP6,PLAP6 | Plastid lipid associated protein 6; (1 of 17) PF04755 - PAP_fibrillin (PAP_fibrillin) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AACCGAACCCAATGGGGGGGACGCCGCTGGCCACGCTCACACTCGGGGGC |
| Internal bar code: | AATCACGTTGATTTACAACGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1609 |
| LEAP-Seq percent confirming: | 95.6522 |
| LEAP-Seq n confirming: | 22 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCCTCGTTATGCTTACGCC |
| Suggested primer 2: | TCTGTCGCTTCCATGCCTTT |