| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.001063 |
| Chromosome: | chromosome 14 |
| Location: | 1106432 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g614750 | CPNAT1,cpNAT1,NAT34 | (1 of 1) 2.3.1.189 - Mycothiol synthase; Ribosome-associated chloroplast-localized N-acetyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTTTGCGCGCTCCTTTGTGATGTGCCTCTCGCTGCGCCCAACAGGTGGC |
| Internal bar code: | ACGCGGTACGTTCGAGGTTATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 442 |
| LEAP-Seq percent confirming: | 66.6667 |
| LEAP-Seq n confirming: | 2 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGATGTCTCGCCAAATGCA |
| Suggested primer 2: | GTGGGGTCGCTGAAGAAGAA |