| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.001112 |
| Chromosome: | chromosome 6 |
| Location: | 100411 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g249650 | CGL55 | conserved protein related to cleavage and polyadenylation factor 6; (1 of 1) PF03031//PF12738 - NLI interacting factor-like phosphatase (NIF) // twin BRCT domain (PTCB-BRCT) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCTCCGCCAGCCGCCACAACGGGTGCTGAGGCCCAGCCGCCGTGCCGCC |
| Internal bar code: | TTGTACTTTTTGTCCTTGTCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 489 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 7 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGCACTGCTCATATGGCCAA |
| Suggested primer 2: | CTTTGCACTCTGGCCTCTCA |