| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | - |
| Strain: | CLIP2.001178 |
| Chromosome: | chromosome 9 |
| Location: | 5334128 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g407600 | TEN1 | Conserved TenA familiy member; (1 of 1) PTHR20858//PTHR20858:SF18 - PHOSPHOMETHYLPYRIMIDINE KINASE // PROTEIN PET18 | 3'UTR |
| Cre09.g407650 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGATGCAAGGCTGCCTGCCAAGGCGCCATAGGCGTTCTGGTCAGTTCT |
| Internal bar code: | ACCATAGTGTCTAGGGCCCTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 303 |
| LEAP-Seq percent confirming: | 4.34783 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 23 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAATGTGGCGTGACGTGTTG |
| Suggested primer 2: | GTTGTCAAGAACACGGGCAC |