| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.001179 |
| Chromosome: | chromosome 1 |
| Location: | 7125909 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g051000 | PRM | Protein-/Histone-arginine N-methyltransferase; (1 of 1) PTHR11006//PTHR11006:SF53 - PROTEIN ARGININE N-METHYLTRANSFERASE // PROTEIN ARGININE N-METHYLTRANSFERASE 3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACCACCATAAACAGATTAACTGCTGCCCACCGCCTCTTCAGGACGTGGCT |
| Internal bar code: | TAGCTCGGCCCTCGGGTGGTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2405 |
| LEAP-Seq percent confirming: | 97.4359 |
| LEAP-Seq n confirming: | 38 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 39 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCAATAGCCCCCAACGATG |
| Suggested primer 2: | CAAAAGTGAGTTGGGCAGGC |