| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.001201 |
| Chromosome: | chromosome 1 |
| Location: | 4697454 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g032550 | CGL127 | (1 of 1) K11267 - sister chromatid cohesion protein PDS5 (PDS5); Conserved in the Green Lineage | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AAGGAGGTGCGGGGCATTGGGCCGGCCGCGGCTGCAGCAGCGGCAGCGAT |
| Internal bar code: | CTTCGACGCTCATGTAGGGAAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2515 |
| LEAP-Seq percent confirming: | 40.0 |
| LEAP-Seq n confirming: | 26 |
| LEAP-Seq n nonconfirming: | 39 |
| LEAP-Seq n unique pos: | 65 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCAGACAATGTGCATAGCG |
| Suggested primer 2: | ATCCTACTCAGCCCCACCAT |