| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.001202 |
| Chromosome: | chromosome 13 |
| Location: | 668240 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g566200 | CGL112 | possible transcription factor; (1 of 19) PF00642 - Zinc finger C-x8-C-x5-C-x3-H type (and similar) (zf-CCCH) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAGCCTGGGGGGAAAACCATCAGCCAGCTACAAGACTGCTCCGCCACTCC |
| Internal bar code: | TGTTGTACTTCCAAGTATAATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1966 |
| LEAP-Seq percent confirming: | 80.8511 |
| LEAP-Seq n confirming: | 38 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAACAAGCCCTGCTCACAC |
| Suggested primer 2: | CAAGCCCGAGAACCTGATGA |