| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.001267 |
| Chromosome: | chromosome 17 |
| Location: | 2507083 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g715700 | VTC3,PPP44,PP2C5 | (1 of 1) PF00481//PF07714 - Protein phosphatase 2C (PP2C) // Protein tyrosine kinase (Pkinase_Tyr); protein phosphatase 2C-like | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCGACTGAACCCCACCTCACCTATGCAATATGCCCAAGCACAAACACGC |
| Internal bar code: | TGACAGATATAGGGGGTTGCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2392 |
| LEAP-Seq percent confirming: | 43.1818 |
| LEAP-Seq n confirming: | 19 |
| LEAP-Seq n nonconfirming: | 25 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAGTACTTCACGCACTGGC |
| Suggested primer 2: | TGTGAACAGCCCCTTGTTGT |