| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.001297 |
| Chromosome: | chromosome 12 |
| Location: | 4555890 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g521450 | CLPP2 | (1 of 1) PTHR10381//PTHR10381:SF11 - ATP-DEPENDENT CLP PROTEASE PROTEOLYTIC SUBUNIT // ATP-DEPENDENT CLP PROTEASE PROTEOLYTIC SUBUNIT, MITOCHONDRIAL-RELATED; peptidase subunit of mitochondrial ClpXP protease | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCTTGCCGAAACCCCAGTGCCTCCAACTCCCGCCGGGACTCACACTGCT |
| Internal bar code: | ATGGTGTGCCATAAGCACTATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 840 |
| LEAP-Seq percent confirming: | 58.3333 |
| LEAP-Seq n confirming: | 14 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTGCAATCCTCACACAGT |
| Suggested primer 2: | GTGGACTGCTTGACGGTGTA |