| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | CLIP2.001432 |
| Chromosome: | chromosome 9 |
| Location: | 1472140 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g399914 | SSA8 | cilia-sensing, structure and/or assembly; (1 of 1) K10766 - alkylated DNA repair protein alkB homolog 4 (ALKBH4) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAACAAGGAGGTGGCTGCCTTAGGGAGGCAGGAAAAGGGCTGAGCCCTCC |
| Internal bar code: | AATGCCTATCGCACAGGTCATG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2828 |
| LEAP-Seq percent confirming: | 98.1132 |
| LEAP-Seq n confirming: | 52 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 53 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGAGTACACAGCGGTCCC |
| Suggested primer 2: | CTCCGACACGTCCGACATAG |