| Insertion cassette: | CIB2 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | CLIP2.001449 |
| Chromosome: | chromosome 2 |
| Location: | 2424587 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g091400 | CLPB2 | (1 of 1) IPR001270//IPR003593//IPR003959//IPR024064//IPR027417 - ClpA/B family // AAA+ ATPase domain // ATPase, AAA-type, core // FdhE-like // P-loop containing nucleoside triphosphate hydrolase; ClpB chaperone, Hsp100 family | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGATGCGGAGCGGGAGGCGGTGGCGGCGGAGCGGGAGGTGCCAAAGGCCT |
| Internal bar code: | GGCGCTTTGTATCTGACACACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1384 |
| LEAP-Seq percent confirming: | 83.3333 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATATCAGCGTCGTCCTCGTC |
| Suggested primer 2: | TCCCAATTCCAGCCAAGACC |