Insertion cassette: | CIB2 |
Side of cassette: | 3' truncated? |
Strand: | + |
Strain: | CLIP2.001464 |
Chromosome: | chromosome 12 |
Location: | 9724661 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g554103 | CGL74 | (1 of 1) PTHR26312//PTHR26312:SF0 - FAMILY NOT NAMED // TETRATRICOPEPTIDE REPEAT PROTEIN 5; conserved expressed TPR repeat protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGTACGGAGGGAACAGGCGACGGGCCCTCAGTAGTGCCAGTCACTACCA |
Internal bar code: | GAAACGGGGATGAGCGGTTGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 75 |
LEAP-Seq percent confirming: | 50.0 |
LEAP-Seq n confirming: | 9 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGGACGCATACATCGCCAAT |
Suggested primer 2: | AAAGGGAAACAAAAGCGCCC |