| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | CLIP2.001501 |
| Chromosome: | chromosome 9 |
| Location: | 782173 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g404000 | CPLD59 | (1 of 1) PF00805 - Pentapeptide repeats (8 copies) (Pentapeptide); thylakoid lumenal 17.4 kDa protein | 3'UTR |
| Cre09.g404050 | (1 of 40) PTHR23257//PTHR23257:SF513 - SERINE-THREONINE PROTEIN KINASE // SUBFAMILY NOT NAMED | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTTGGGCCCTCGGCTGTCCCACCGCCCTGGACCCTGGGCCGGGGCATG |
| Internal bar code: | TACACTATTCTGATGCGAGTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 2543 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 42 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 42 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAGCCTGTGACCTAAAGCCA |
| Suggested primer 2: | CCGGGCAATGCAAGCTAATC |