| Insertion cassette: | CIB2 |
| Side of cassette: | 3' truncated? |
| Strand: | + |
| Strain: | CLIP2.001513 |
| Chromosome: | chromosome 7 |
| Location: | 1140658 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g320750 | CYG12 | Adenylate/guanylate cyclase, nitric oxide sensing; (1 of 5) K12319 - guanylate cyclase soluble subunit beta (GUCY1B) | 3'UTR |
| Cre07.g320800 | (1 of 1) PF09468 - Ydr279p protein family (RNase H2 complex component) (RNase_H2-Ydr279) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACAGAGTGTCTGGGTGCGTCTGCGCCCCCACCCGCCCCATGGCAGCGCT |
| Internal bar code: | GCCATCACGAGATATATATTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1350 |
| LEAP-Seq percent confirming: | 93.75 |
| LEAP-Seq n confirming: | 15 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGGGACGATTGGATTGCGA |
| Suggested primer 2: | AAGCGTTGCCTTTTGCGATT |