Insertion cassette: | CIB2 |
Side of cassette: | 5' truncated? |
Strand: | - |
Strain: | CLIP2.001515 |
Chromosome: | chromosome 3 |
Location: | 5992429 |
Confidence (%): | 80 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g189500 | (1 of 3) K03574 - 8-oxo-dGTP diphosphatase [EC:3.6.1.55] (mutT, NUDT15, MTH2) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCGCATGTGCCATGGTGCTGCGCGCCGTCGCGGCTCCTCGTTGCCACC |
Internal bar code: | CGTAGCGTCGATATGCAAGGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1935 |
LEAP-Seq percent confirming: | 94.4444 |
LEAP-Seq n confirming: | 17 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 18 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGCGCTAACCAGTTTCCTC |
Suggested primer 2: | ACCCAAGATGCCGTAATGCA |