| Insertion cassette: | CIB2 |
| Side of cassette: | 5' truncated? |
| Strand: | + |
| Strain: | CLIP2.001532 |
| Chromosome: | chromosome 6 |
| Location: | 3719035 |
| Confidence (%): | 80 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278159 | CRCO,CO,CON1,CONSTANS | CONSTANS-like protein involved in circadian rhythms; (1 of 1) PF00643//PF06203 - B-box zinc finger (zf-B_box) // CCT motif (CCT) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGACTTCTCGCTCTCTTTTACAGGGCGCTGCACCGGAGCCTCAGGTCCTG |
| Internal bar code: | AAACCTGCGTTCCACAAACAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 3756 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 90 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 90 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CATGCGTAAGGGAATGCAGC |
| Suggested primer 2: | TCGGATGGCGTGGATATGTG |