| Insertion cassette: | CIB2 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | CLIP2.001571 |
| Chromosome: | chromosome 13 |
| Location: | 1700490 |
| Confidence (%): | 63 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g574200 | PAP2 | (1 of 3) K03514 - non-canonical poly(A) RNA polymerase PAPD5/7 (PAPD5_7, TRF4); Class-II RNA nucleotidyl transferase 2 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATTGTGGAGATGATGGAGGCTGGATGGGCGGTTCGTCTGAGTGGCTGTGA |
| Internal bar code: | AGGTTCGTACCAGCCGTGGGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 445 |
| LEAP-Seq percent confirming: | 25.0 |
| LEAP-Seq n confirming: | 1 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGCTGTGATCCTCCTGCAA |
| Suggested primer 2: | GAGCGAGAATGAAAGCAGCG |